Basics of PCR

The Basics of Polymerase Chain Reaction

Polymerase chain reaction (PCR) is a valuable tool for genetics researchers that allows them to easily amplify or make millions of copies of specific genes. Even very tiny amounts of DNA can be amplified and then studied. The PCR process was invented by Kary B. Mullis, who won a Nobel Prize in Chemistry in 1993.

DNA Basics
Deoxyribonucleic acid (DNA) is a long molecule made up of a chain of nucleotides. Nucleotides are made up of a phosphate, a sugar, and a base. There are four types of bases: adenine, thymine, cytosine, and guanine. They are often represented by letters, and a string of DNA could be written as AATCGTAATACGTATATCCCCG.
[nucleotide diagram showing 3 components]

DNA is a very long molecule; if we stretched out all the DNA in just one of your cells it would be about six feet long. Sections of DNA are called genes. The order of nucleotides, or sequence, is the “genetic code”, which is very specific. For example, sickle cell anemia is caused by a point mutation, or one wrong letter in the genetic sequence of hemoglobin.

Double Helix
Your DNA (and the DNA in other animals and plants) is double-stranded. The nucleotides on one strand are matched to their complement on the other strand

  • Purines (T and C) complement Pyrimidies (A and G)
  • A complements T
  • C complements G

ATCGTAATACGTATATCCCCGGGACT
TAGCATTATGCATATAGGGGCCCTGA

The components of PCR
Every PCR requires these ingredients

  1. template DNA from which the gene will be amplified, this is your sample that you extracted.
  2. deoxynucleotide triphosphates (dNTPs), the “letters” A, C, T, G
  3. Primers, which bookend the segment you want to amplify. Primers bind to their complementary sequence on the template strand. Often, several pairs of primers are needed to amplify a long gene. Researchers may be interested in only a small section of the gene.
  4. Taq polymerase, an enzyme which carries out the polymerization. Taq stands for Thermus aquaticus an archaebacteria that lives in hot springs and hydrothermal vents. The ability to live in these extreme environments means its DNA polymerase enzyme is heat-stable.
  5. Thermocycler, a piece of scientific equipment which is programmed to precisely warm and cool PCR reactions for specific periods of time
  6. Buffer, maintains the proper pH and contains necessary ingredients for the reactiontemplate_strand

PCR reaction steps

  1. Denaturation: raise temperature until double stranded DNA melts into single stranded DNA.
  2. Annealing: lower the temperature so the primers can attach.
  3. Extension: Taq enzyme adds dNTPs onto primers to make double stranded DNA.

These steps are repeated up to 40 times. The times and temperatures depend on how long the primers and target segment are. For example, longer segments require higher temperatures and longer times to denature; lower temperatures can make primer attachment less accurate; and longer target segments need longer extension times.

Polymerase_Chain_Reaction